                                supermatcher



Wiki

   The master copies of EMBOSS documentation are available at
   http://emboss.open-bio.org/wiki/Appdocs on the EMBOSS Wiki.

   Please help by correcting and extending the Wiki pages.

Function

   Calculate approximate local pair-wise alignments of larger sequences

Description

   supermatcher calculates an approximate alignment between all the
   sequences in a first set of sequences and all those from a second
   stream, typically a database. The alignments are written to a standard
   alignment file. A combination of a word-match and Smith-Waterman local
   alignment (dynamic programming) algorithms are used. The alignments
   will be less accurate than an optimal alignment generated by full
   dynamic programming, but the program will run faster and use less
   memory, which means it is suitable for use with larger sequences.

Usage

   Here is a sample session with supermatcher


% supermatcher @eclac.list tembl:j01636 -word 50
Calculate approximate local pair-wise alignments of larger sequences
Gap opening penalty [10.0]:
Gap extension penalty [0.5]: 3.0
Output alignment [j01636.supermatcher]:


   Go to the input files for this example
   Go to the output files for this example

Command line arguments

Calculate approximate local pair-wise alignments of larger sequences
Version: EMBOSS:6.6.0.0

   Standard (Mandatory) qualifiers:
  [-asequence]         seqall     Sequence(s) filename and optional format, or
                                  reference (input USA)
  [-bsequence]         seqset     Sequence set filename and optional format,
                                  or reference (input USA)
   -gapopen            float      [10.0 for any sequence type] Gap opening
                                  penalty (Number from 0.000 to 100.000)
   -gapextend          float      [0.5 for any sequence type] Gap extension
                                  penalty (Number from 0.000 to 10.000)
  [-outfile]           align      [*.supermatcher] Output alignment file name
                                  (default -aformat simple)

   Additional (Optional) qualifiers:
   -datafile           matrixf    [EBLOSUM62 for protein, EDNAFULL for DNA]
                                  This is the scoring matrix file used when
                                  comparing sequences. By default it is the
                                  file 'EBLOSUM62' (for proteins) or the file
                                  'EDNAFULL' (for nucleic sequences). These
                                  files are found in the 'data' directory of
                                  the EMBOSS installation.
   -minscore           float      [0] Minimum alignment score to report an
                                  alignment. (Number 0.000 or more)
   -width              integer    [16] Alignment width (Integer 1 or more)
   -wordlen            integer    [6] Word length for initial matching
                                  (Integer 3 or more)
   -errfile            outfile    [supermatcher.error] Error file to be
                                  written to for failed alignments

   Advanced (Unprompted) qualifiers: (none)
   Associated qualifiers:

   "-asequence" associated qualifiers
   -sbegin1            integer    Start of each sequence to be used
   -send1              integer    End of each sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -scircular1         boolean    Sequence is circular
   -squick1            boolean    Read id and sequence only
   -sformat1           string     Input sequence format
   -iquery1            string     Input query fields or ID list
   -ioffset1           integer    Input start position offset
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-bsequence" associated qualifiers
   -sbegin2            integer    Start of each sequence to be used
   -send2              integer    End of each sequence to be used
   -sreverse2          boolean    Reverse (if DNA)
   -sask2              boolean    Ask for begin/end/reverse
   -snucleotide2       boolean    Sequence is nucleotide
   -sprotein2          boolean    Sequence is protein
   -slower2            boolean    Make lower case
   -supper2            boolean    Make upper case
   -scircular2         boolean    Sequence is circular
   -squick2            boolean    Read id and sequence only
   -sformat2           string     Input sequence format
   -iquery2            string     Input query fields or ID list
   -ioffset2           integer    Input start position offset
   -sdbname2           string     Database name
   -sid2               string     Entryname
   -ufo2               string     UFO features
   -fformat2           string     Features format
   -fopenfile2         string     Features file name

   "-outfile" associated qualifiers
   -aformat3           string     Alignment format
   -aextension3        string     File name extension
   -adirectory3        string     Output directory
   -aname3             string     Base file name
   -awidth3            integer    Alignment width
   -aaccshow3          boolean    Show accession number in the header
   -adesshow3          boolean    Show description in the header
   -ausashow3          boolean    Show the full USA in the alignment
   -aglobal3           boolean    Show the full sequence in alignment

   "-errfile" associated qualifiers
   -odirectory         string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write first file to standard output
   -filter             boolean    Read first file from standard input, write
                                  first file to standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options and exit. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages
   -version            boolean    Report version number and exit


Input file format

   supermatcher reads two sets of nucleotide or protein sequences.

   The input is a standard EMBOSS sequence query (also known as a 'USA').

   Major sequence database sources defined as standard in EMBOSS
   installations include srs:embl, srs:uniprot and ensembl

   Data can also be read from sequence output in any supported format
   written by an EMBOSS or third-party application.

   The input format can be specified by using the command-line qualifier
   -sformat xxx, where 'xxx' is replaced by the name of the required
   format. The available format names are: gff (gff3), gff2, embl (em),
   genbank (gb, refseq), ddbj, refseqp, pir (nbrf), swissprot (swiss, sw),
   dasgff and debug.

   See: http://emboss.sf.net/docs/themes/SequenceFormats.html for further
   information on sequence formats.

  Input files for usage example

   'tembl:j01636' is a sequence entry in the example nucleic acid database
   'tembl'

  File: eclac.list

#Formerly ECLAC
tembl:J01636

#Formerly ECLACA
tembl:X51872

#Formerly ECLACI
tembl:V00294

#Formerly ECLACY
tembl:V00295

#Formerly ECLACZ
tembl:V00296

  Database entry: tembl:j01636

ID   J01636; SV 1; linear; genomic DNA; STD; PRO; 7477 BP.
XX
AC   J01636; J01637; K01483; K01793;
XX
DT   30-NOV-1990 (Rel. 26, Created)
DT   09-SEP-2004 (Rel. 81, Last updated, Version 8)
XX
DE   E.coli lactose operon with lacI, lacZ, lacY and lacA genes.
XX
KW   acetyltransferase; beta-D-galactosidase; galactosidase; lac operon;
KW   lac repressor protein; lacA gene; lacI gene; lactose permease; lacY gene;
KW   lacZ gene; mutagenesis; palindrome; promoter region;
KW   thiogalactoside acetyltransferase.
XX
OS   Escherichia coli
OC   Bacteria; Proteobacteria; Gammaproteobacteria; Enterobacteriales;
OC   Enterobacteriaceae; Escherichia.
XX
RN   [1]
RP   1243-1266
RX   DOI; 10.1073/pnas.70.12.3581.
RX   PUBMED; 4587255.
RA   Gilbert W., Maxam A.;
RT   "The nucleotide sequence of the lac operator";
RL   Proc. Natl. Acad. Sci. U.S.A. 70(12):3581-3584(1973).
XX
RN   [2]
RP   1246-1308
RX   DOI; 10.1073/pnas.70.12.3585.
RX   PUBMED; 4587256.
RA   Maizels N.M.;
RT   "The nucleotide sequence of the lactose messenger ribonucleic acid
RT   transcribed from the UV5 promoter mutant of Escherichia coli";
RL   Proc. Natl. Acad. Sci. U.S.A. 70(12):3585-3589(1973).
XX
RN   [3]
RX   PUBMED; 4598642.
RA   Gilbert W., Maizels N., Maxam A.;
RT   "Sequences of controlling regions of the lactose operon";
RL   Cold Spring Harb. Symp. Quant. Biol. 38:845-855(1974).
XX
RN   [4]
RA   Gilbert W., Gralla J., Majors A.J., Maxam A.;
RT   "Lactose operator sequences and the action of lac repressor";
RL   (in) Sund H., Blauer G. (Eds.);
RL   PROTEIN-LIGAND INTERACTIONS:193-207;
RL   Walter de Gruyter, New York (1975)
XX
RN   [5]
RP   1146-1282


  [Part of this file has been deleted for brevity]

     cgatttggct acatgacatc aaccatatca gcaaaagtga tacgggtatt atttttgccg      4560
     ctatttctct gttctcgcta ttattccaac cgctgtttgg tctgctttct gacaaactcg      4620
     ggctgcgcaa atacctgctg tggattatta ccggcatgtt agtgatgttt gcgccgttct      4680
     ttatttttat cttcgggcca ctgttacaat acaacatttt agtaggatcg attgttggtg      4740
     gtatttatct aggcttttgt tttaacgccg gtgcgccagc agtagaggca tttattgaga      4800
     aagtcagccg tcgcagtaat ttcgaatttg gtcgcgcgcg gatgtttggc tgtgttggct      4860
     gggcgctgtg tgcctcgatt gtcggcatca tgttcaccat caataatcag tttgttttct      4920
     ggctgggctc tggctgtgca ctcatcctcg ccgttttact ctttttcgcc aaaacggatg      4980
     cgccctcttc tgccacggtt gccaatgcgg taggtgccaa ccattcggca tttagcctta      5040
     agctggcact ggaactgttc agacagccaa aactgtggtt tttgtcactg tatgttattg      5100
     gcgtttcctg cacctacgat gtttttgacc aacagtttgc taatttcttt acttcgttct      5160
     ttgctaccgg tgaacagggt acgcgggtat ttggctacgt aacgacaatg ggcgaattac      5220
     ttaacgcctc gattatgttc tttgcgccac tgatcattaa tcgcatcggt gggaaaaacg      5280
     ccctgctgct ggctggcact attatgtctg tacgtattat tggctcatcg ttcgccacct      5340
     cagcgctgga agtggttatt ctgaaaacgc tgcatatgtt tgaagtaccg ttcctgctgg      5400
     tgggctgctt taaatatatt accagccagt ttgaagtgcg tttttcagcg acgatttatc      5460
     tggtctgttt ctgcttcttt aagcaactgg cgatgatttt tatgtctgta ctggcgggca      5520
     atatgtatga aagcatcggt ttccagggcg cttatctggt gctgggtctg gtggcgctgg      5580
     gcttcacctt aatttccgtg ttcacgctta gcggccccgg cccgctttcc ctgctgcgtc      5640
     gtcaggtgaa tgaagtcgct taagcaatca atgtcggatg cggcgcgacg cttatccgac      5700
     caacatatca taacggagtg atcgcattga acatgccaat gaccgaaaga ataagagcag      5760
     gcaagctatt taccgatatg tgcgaaggct taccggaaaa aagacttcgt gggaaaacgt      5820
     taatgtatga gtttaatcac tcgcatccat cagaagttga aaaaagagaa agcctgatta      5880
     aagaaatgtt tgccacggta ggggaaaacg cctgggtaga accgcctgtc tatttctctt      5940
     acggttccaa catccatata ggccgcaatt tttatgcaaa tttcaattta accattgtcg      6000
     atgactacac ggtaacaatc ggtgataacg tactgattgc acccaacgtt actctttccg      6060
     ttacgggaca ccctgtacac catgaattga gaaaaaacgg cgagatgtac tcttttccga      6120
     taacgattgg caataacgtc tggatcggaa gtcatgtggt tattaatcca ggcgtcacca      6180
     tcggggataa ttctgttatt ggcgcgggta gtatcgtcac aaaagacatt ccaccaaacg      6240
     tcgtggcggc tggcgttcct tgtcgggtta ttcgcgaaat aaacgaccgg gataagcact      6300
     attatttcaa agattataaa gttgaatcgt cagtttaaat tataaaaatt gcctgatacg      6360
     ctgcgcttat caggcctaca agttcagcga tctacattag ccgcatccgg catgaacaaa      6420
     gcgcaggaac aagcgtcgca tcatgcctct ttgacccaca gctgcggaaa acgtactggt      6480
     gcaaaacgca gggttatgat catcagccca acgacgcaca gcgcatgaaa tgcccagtcc      6540
     atcaggtaat tgccgctgat actacgcagc acgccagaaa accacggggc aagcccggcg      6600
     atgataaaac cgattccctg cataaacgcc accagcttgc cagcaatagc cggttgcaca      6660
     gagtgatcga gcgccagcag caaacagagc ggaaacgcgc cgcccagacc taacccacac      6720
     accatcgccc acaataccgg caattgcatc ggcagccaga taaagccgca gaaccccacc      6780
     agttgtaaca ccagcgccag cattaacagt ttgcgccgat cctgatggcg agccatagca      6840
     ggcatcagca aagctcctgc ggcttgccca agcgtcatca atgccagtaa ggaaccgctg      6900
     tactgcgcgc tggcaccaat ctcaatatag aaagcgggta accaggcaat caggctggcg      6960
     taaccgccgt taatcagacc gaagtaaaca cccagcgtcc acgcgcgggg agtgaatacc      7020
     acgcgaaccg gagtggttgt tgtcttgtgg gaagaggcga cctcgcgggc gctttgccac      7080
     caccaggcaa agagcgcaac aacggcaggc agcgccacca ggcgagtgtt tgataccagg      7140
     tttcgctatg ttgaactaac cagggcgtta tggcggcacc aagcccaccg ccgcccatca      7200
     gagccgcgga ccacagcccc atcaccagtg gcgtgcgctg ctgaaaccgc cgtttaatca      7260
     ccgaagcatc accgcctgaa tgatgccgat ccccacccca ccaagcagtg cgctgctaag      7320
     cagcagcgca ctttgcgggt aaagctcacg catcaatgca ccgacggcaa tcagcaacag      7380
     actgatggcg acactgcgac gttcgctgac atgctgatga agccagcttc cggccagcgc      7440
     cagcccgccc atggtaacca ccggcagagc ggtcgac                               7477
//

Output file format

   The output is a standard EMBOSS alignment file.

   The results can be output in one of several styles by using the
   command-line qualifier -aformat xxx, where 'xxx' is replaced by the
   name of the required format. Some of the alignment formats can cope
   with an unlimited number of sequences, while others are only for pairs
   of sequences.

   The available multiple alignment format names are: multiple, simple,
   fasta, msf, clustal, mega, meganon, nexus,, nexusnon, phylip,
   phylipnon, selex, treecon, tcoffee, debug, srs.

   The available pairwise alignment format names are: pair, markx0,
   markx1, markx2, markx3, markx10, match, sam, bam, score, srspair

   See: http://emboss.sf.net/docs/themes/AlignFormats.html for further
   information on alignment formats.

   By default the output is in 'simple' format.

  Output files for usage example

  File: supermatcher.error


  File: j01636.supermatcher

########################################
# Program: supermatcher
# Rundate: Mon 15 Jul 2013 12:00:00
# Commandline: supermatcher
#    [-asequence] @../../data/eclac.list
#    [-bsequence] tembl:j01636
#    -wordlen 50
#    -gapextend 3.0
# Align_format: simple
# Report_file: j01636.supermatcher
########################################

#=======================================
#
# Aligned_sequences: 2
# 1: J01636
# 2: J01636
# Matrix: EDNAFULL
# Gap_penalty: 10.0
# Extend_penalty: 3.0
#
# Length: 7477
# Identity:    7477/7477 (100.0%)
# Similarity:  7477/7477 (100.0%)
# Gaps:           0/7477 ( 0.0%)
# Score: 37385.0
#
#
#=======================================

J01636             1 gacaccatcgaatggcgcaaaacctttcgcggtatggcatgatagcgccc     50
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
J01636             1 gacaccatcgaatggcgcaaaacctttcgcggtatggcatgatagcgccc     50

J01636            51 ggaagagagtcaattcagggtggtgaatgtgaaaccagtaacgttatacg    100
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
J01636            51 ggaagagagtcaattcagggtggtgaatgtgaaaccagtaacgttatacg    100

J01636           101 atgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtg    150
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
J01636           101 atgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtg    150

J01636           151 aaccaggccagccacgtttctgcgaaaacgcgggaaaaagtggaagcggc    200
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
J01636           151 aaccaggccagccacgtttctgcgaaaacgcgggaaaaagtggaagcggc    200

J01636           201 gatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgg    250
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
J01636           201 gatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgg    250



  [Part of this file has been deleted for brevity]

V00296          2501 tgctgattacgaccgctcacgcgtggcagcatcaggggaaaaccttattt   2550
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
J01636          3787 tgctgattacgaccgctcacgcgtggcagcatcaggggaaaaccttattt   3836

V00296          2551 atcagccggaaaacctaccggattgatggtagtggtcaaatggcgattac   2600
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
J01636          3837 atcagccggaaaacctaccggattgatggtagtggtcaaatggcgattac   3886

V00296          2601 cgttgatgttgaagtggcgagcgatacaccgcatccggcgcggattggcc   2650
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
J01636          3887 cgttgatgttgaagtggcgagcgatacaccgcatccggcgcggattggcc   3936

V00296          2651 tgaactgccagctggcgcaggtagcagagcgggtaaactggctcggatta   2700
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
J01636          3937 tgaactgccagctggcgcaggtagcagagcgggtaaactggctcggatta   3986

V00296          2701 gggccgcaagaaaactatcccgaccgccttactgccgcctgttttgaccg   2750
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
J01636          3987 gggccgcaagaaaactatcccgaccgccttactgccgcctgttttgaccg   4036

V00296          2751 ctgggatctgccattgtcagacatgtataccccgtacgtcttcccgagcg   2800
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
J01636          4037 ctgggatctgccattgtcagacatgtataccccgtacgtcttcccgagcg   4086

V00296          2801 aaaacggtctgcgctgcgggacgcgcgaattgaattatggcccacaccag   2850
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
J01636          4087 aaaacggtctgcgctgcgggacgcgcgaattgaattatggcccacaccag   4136

V00296          2851 tggcgcggcgacttccagttcaacatcagccgctacagtcaacagcaact   2900
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
J01636          4137 tggcgcggcgacttccagttcaacatcagccgctacagtcaacagcaact   4186

V00296          2901 gatggaaaccagccatcgccatctgctgcacgcggaagaaggcacatggc   2950
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
J01636          4187 gatggaaaccagccatcgccatctgctgcacgcggaagaaggcacatggc   4236

V00296          2951 tgaatatcgacggtttccatatggggattggtggcgacgactcctggagc   3000
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
J01636          4237 tgaatatcgacggtttccatatggggattggtggcgacgactcctggagc   4286

V00296          3001 ccgtcagtatcggcggaattccagctgagcgccggtcgctaccattacca   3050
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
J01636          4287 ccgtcagtatcggcggaattccagctgagcgccggtcgctaccattacca   4336

V00296          3051 gttggtctggtgtcaaaaataataataa   3078
                     ||||||||||||||||||||||||||||
J01636          4337 gttggtctggtgtcaaaaataataataa   4364


#---------------------------------------
#---------------------------------------

   The file 'supermatcher.error' will contain any errors that occured
   during the program. This may be that wordmatch could not find any
   matches hence no suitable start point is found for the smith-waterman
   calculation.

Data files

   For protein sequences EBLOSUM62 is used for the substitution matrix.
   For nucleotide sequence, EDNAMAT is used. Others can be specified.

   EMBOSS data files are distributed with the application and stored in
   the standard EMBOSS data directory, which is defined by the EMBOSS
   environment variable EMBOSS_DATA.

   To see the available EMBOSS data files, run:

% embossdata -showall

   To fetch one of the data files (for example 'Exxx.dat') into your
   current directory for you to inspect or modify, run:

% embossdata -fetch -file Exxx.dat


   Users can provide their own data files in their own directories.
   Project specific files can be put in the current directory, or for
   tidier directory listings in a subdirectory called ".embossdata". Files
   for all EMBOSS runs can be put in the user's home directory, or again
   in a subdirectory called ".embossdata".

   The directories are searched in the following order:
     * . (your current directory)
     * .embossdata (under your current directory)
     * ~/ (your home directory)
     * ~/.embossdata

Notes

   supermatcher generates approximate local alignments for large
   sequences. The alignments are approximate because as a first step, all
   the sequence word matches between two sequences are found. By
   identifying the highest scoring, non-overlapping matches a set of
   approximate local alignments are calculated for two sequences. These
   give the centre points for more acurate Smith-Waterman type alignments
   in a region of width specified by the user. The use of Smith-Waterman
   in narrow regions means the alignment overall will be rough, but due to
   the memory saving much larger sequences can be aligned.

   For the Swmith-Waterman alignment, the gap open and extension penalties
   and substition matrix may be specified, the later by default is
   EBLOSUM62 for protein sequences and EDNAMAT for nucleotide sequence.

   For the word-match alignment, the word length may be specified. The
   time required for alignment depends very much on word size. A small
   word size (e.g. 4) may take a very long time even for short sequences.
   Much larger word sizes (e.g. 30) will give a very quick result. The
   default of 16 should give reasonably fast alignments.

References

   None.

Warnings

   supermatcher performs a Smith & Waterman alignment (albeit in a narrow
   best-matching regions identified by simple word-match) and therefore
   can use huge amounts of memory if the sequences are large. The longer
   the sequences and the wider the specified alignment width, the more
   memory will be used. If the program terminates due to lack of memory
   you can try running the UNIX command limit to see if your stack or
   memory usage have been limited and if so, run unlimit, (e.g.: % unlimit
   stacksize).

   supermatcher has two sequence inputs. The first (asequence) is a
   database or large file which is read one sequence at a time. The second
   (bsequence) is a "sequence set" which is loaded into memory. If one of
   the inputs has more number of sequences than the other one, specifying
   the file with many number of sequences first would be useful to
   decrease the amount of memory used while supermatcher running.

   Because the alignment is made within a narrow area each side of the
   'best' diagonal identified by word-matching, if there are sufficient
   indels between the two sequences, then the path of the Smith & Waterman
   alignment can wander outside of this area. Making the width larger can
   avoid this problem, but you then use more memory.

Diagnostic Error Messages

   None.

Exit status

   It always exits with a status of 0.

Known bugs

   None.

See also

                    Program name                        Description
                    matcher      Waterman-Eggert local alignment of two sequences
                    seqmatchall  All-against-all word comparison of a sequence set
                    water        Smith-Waterman local alignment of sequences
                    wordfinder   Match large sequences against one or more other sequences
                    wordmatch    Find regions of identity (exact matches) of two sequences

Author(s)

   Ian              Longden formerly at:
   Sanger           Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge,
                    CB10 1SA, UK.

                    Please report all bugs to the EMBOSS bug team
                    (emboss-bug (c) emboss.open-bio.org) not to the original author.

History

Target users

                    This program is intended to be used by everyone and everything, from
                    naive users to embedded scripts.

Comments

                    None
